Seite 1 von 4 1234 LetzteLetzte
Ergebnis 1 bis 10 von 31

Thema: Recombination, Grundlagen, Stellenwert

  1. #1

    Registriert seit
    24.06.2007
    Beiträge
    415

    Recombination, Grundlagen, Stellenwert

    Vorraussetzung für Recombination ist nach jetziger Kenntnis eine Doppelinfektion mit zwei verschiedenen Virentypen in ein und derselben Zelle. In ausnahmefällen mag auch eine fehlerhafte Ablesung an der "falschen Stelle" eine Rolle spielen. Also:


    ATGAAAGTGCCTAAAGTTGAATTAATTGTGGTTGT= Virus 1
    ATGCAAGTGACTTAATATGAATTAATTGTGATTGT= Virus 2
    ATGAAAGTGACTTAATATGAATTAATTGTGGTTGT= recombiniertes Tochtervirus
    Das Tochtervirus enthält überwiegend Genmaterial von Virus 1 (=rot) mit Ausnahme eines kurzen Bereichs, der "versehentlich" von Virus 2 eingefügt wurde (unterstrichen). So kann es ganz schnell zu einer Otpimierung der Virus Fitness kommen, ohne dass lange Perioden von zufallsbedingten Mutationsprozessen abgewartet werden müssen.

    eine solche Recombination ist im alignment leicht am plötzlichen Auftreten zahlreicher Änderungen ("Mismatches) bei, in den übrigen Bereichen bestehender, grosser Übereinstimmung zu erkennen.

    Über die Bedeutung dieses Mechanismus gehen die Meinungen hochgradig auseinander, Die meisten, wie Webster glauben, dass R ziemlich selten ist, und die meisten Änderungen Zufallsmutationen sind.
    Andere, wie Niman glauben, dass dies die Haupttriebfeder der Virusevolution ist, der nicht zufallsbedingt, sondern sogar steuerbar ist, (sog copy choice).

    Wir werden diesen Disput nicht beantworten, allenfalls eine Meinung bilden können. Sicher ist, dass Rekombination vorkommt und einige unzweifelhafte Fälle dokumentiert sind.

    Diie interessantere Frage ist, wie die Analysepraxis mit Doppelinfektionen umgeht. Ich denke mal, wenn für Virus 2 der Primer nicht passt, wird eben nur Virus 1 nachgewiesen. Kommt es beim zweiten Durchlauf zu einem anderen Ergebnis (was richtig wäre) so wird das als Fehler gewertet und verworfen. Vielleicht kommt es bei der RNA extraction schon zu Problemen.

    Meinungen?

  2. #2
    Avatar von Klausemann
    Registriert seit
    13.02.2005
    Ort
    Berlin
    Beiträge
    8.718
    Meinungen nein, aber eine Zwischenfrage
    Hallo Sarcelle,
    ich spreche ja ungerne da zwichen aber könntest du mir netter Weise erklären, was die Buchstabenreihen bedeuten ohne das ich einen Crashkurs als Viruloge starten muss .

    Gruss Klaus
    Fuck Terrorism

  3. #3
    Moderator Avatar von MonaLisa
    Registriert seit
    27.01.2005
    Ort
    Speckgürtel von Berlin
    PLZ
    16540
    Land
    D-Oberhavel
    Beiträge
    5.764
    Hallo Klaus,
    schau mal hier:
    http://de.wikipedia.org/wiki/Nukleotid

    Die Buchstaben sind Abkürzungen für die 5 Nukleobasen aus denen unsere Gene bestehen. Sie stellen den Code der DNA oder RNA dar und dienen somit zur Identifizierung zB eines Virus. Die Buchstaben geben die Reihenfolge der Nukleobasen auf dem DNA-Strang an.

    Gruß Petra
    Unser Kopf ist rund, damit das Denken die Richtung ändern kann. Francis Picabia
    Ein Tropfen Hilfe ist wertvoller, als ein Ozean voller Sympathie. Verfasser unbekannt

  4. #4

    Registriert seit
    13.02.2006
    Beiträge
    2.009
    Ich bin zwar nicht Sarcelle, aber er wird mich sicher verbessern oder ergänzen, wenn was fehlt/falsch ist.

    Die vier Buchstaben stehen für die 4 Basen aus denen unsere Erbinformationen auf den Chromosomen aufgebaut sind.
    A = Adenin
    C = Cytosin
    G = Guanin
    T = Thymin
    Es stehen sich immer A und T, bzw. C und G gegenüber.
    Eine grafische Darstellung findet sich u.a. bei Wiki: DNS

    Das Ganze sieht im Grunde aus wie ein Reißverschluß. Die Basen kann man sich wie die einzelnen Glieder vorstellen. Der Ruhezustand ist der geschlossene Reißverschluß, aber er kann auch aufgemacht werden.
    Diese Basenpaare sind eigentlich nur ein Code für Substanzen, die die Zelle produzieren (synthetisieren) kann.

    Ein Virus kann praktisch diese Kette aus Basen aufschneiden und den eigenen Code einfügen. Dadurch produziert die Zelle nicht mehr die Stoffe, die sie produzieren soll, sondern Kopien des Virus.

    Was Sarcelle mit dem oben sagen wollte, war dass, wenn zwei verschiedene Viren in einer Zelle zusammentreffen und beide ihren genetischen Code dort einschleusen, hinterher ihre Kopien (denn nichts anderes sind ihre Nachkommen) verändert dort rauskommen. Sie haben was von beiden Viren abbekommen.
    Diese Veränderung kann man in der Basenabfolge erkennen.

    Hoffe, das hilft etwas.


    PS: Hm, war mal wieder jemand schneller.

  5. #5
    Avatar von Klausemann
    Registriert seit
    13.02.2005
    Ort
    Berlin
    Beiträge
    8.718
    Danke euch beiden, ich denke es hat geholfen.

    Jetzt meine Meinung dazu in Laienäsisch

    H5N1 ist eine unendliche Geschichte mit seinen immer wieder veränderten Untertypen , wo keiner genau weiss wo das endet und gegen das noch nicht mal Rumiflu hilft .

    Es wird niemals einen Impfstoff gegen die Grippe geben.

    Gruss Klaus
    Fuck Terrorism

  6. #6

    Registriert seit
    24.06.2007
    Beiträge
    415
    Themenstarter
    Danke für die Hinweise. Fehlt eigentlich nur noch der Hinweis, dass
    drei solche (Nucleo-)Basen, ein Basentriplett oder "Codon" ergeben, welches jeweils eine Aminosäure kodiert. Ein aus 60 Aminosäuren bestehendes Eiweiss benötigt zu seiner Kodierung also 60 Codons oder 180 Nucleobasen. Insgesamt könnten damit 4 (3) = 64 AS kodiert werden. Da aber nur 20 vorkommen, gibt es für einige Aminosäuren gleich mehrere unterschiedliche Codons.
    http://de.wikipedia.org/wiki/Codon#Codon

    Die fünfte wichtige Base ist das U (=Uracil), welches dem T (Thymidin) entspricht. In der DNA kommt Thymidin vor, diesem entspricht in der RNA das Uracil.

    Damit die Zelle weiß, wo das Eiweis anfängt und wo die Kette zuende ist, wird noch ein Starcodon und ein Stopcodon benötigt. Das Startcodon ist im allgemeinen die Folge ATG. Als Stopcodon gibt es diverse Abfolgen: TAA, TAG. TGA.

    Aus dem oben gesagten ( 64 Möglichkeiten, aber nur 20 AS) ergibt sich, dass nicht jede Änderung einer Base (Genotyp) zu einer anderen Aminosäure (Phänotyp) führen muss. In dem Fall spricht man von einer "silent (=synonyme) Mutation. Silent mutations erlauben aber eine Zuordnung, obwohl der Phänotyp identisch ist. Man kann das Verhätlnis aus silent (synomym)
    zu den restlichen ("non synonyme") Mutationen bestimmen. Wenn optimale Anpassung und Firness vorliegt, findet man sehr viele silent (synonyme) mutations und nur wenige non synonyme Mutationen.

  7. #7

  8. #8
    Avatar von Tadorna
    Registriert seit
    26.08.2005
    Beiträge
    167
    http://www.flutrackers.com/forum/showthread.php?t=61120
    Da findet ja eine kuriose Diskussion statt. Niman geht es m.M.n. in erster Linie darum, im Geschäft zu bleiben. Deshalb verteidigt er seine copy choice Theorie mit Zähnen und Klauen. Etwas wirklich überzeugendes habe ich bisher hierhzu nicht gefunden, genausowenig, wie er bisher recombinationen vorausgesagt hat.

    Das ganze erinnert erntfernt an eine Verschwörungstheorie der anderen Art.

  9. #9
    ja, niman ist augenscheinlich voreingenommen hier.
    Moeglicherweise aber die anderen Forscher auch ... in der anderen
    Richtung. Olsen,Webster erwaehnen nicht die "Merkwuerdigkeit"
    bei den Kanadischen Schweinen in ihren Artikeln ueber das
    Thema.

    Es es etliche Hinweise fuer Rekombination in H9N2
    und H5N1, schwer vorstellbar dass das alles irgendwie
    Laboratorium-Kontamination oder sonstige Fehler sein sollen.

    Ich konnte allerdings bisher kein Beispiel finden dass klar zeigt
    wie rekombinierte Grippe-Viren ueberleben und sich weiterverbreiten:
    wenn man so ca. 1% der klarsten Kandidaten aus den
    Datenbanken entfernt kann man keine klaren Rekombinations-
    Hinweise mehr finden.


    Fuer die niman-schen kurzen Rekombinationen (einzelne Nukleotide)
    gibt es m.E. kaum Indizien, aber etliches was dagegen spricht.

    -----------------------------

    Nun hab' ich mal fuer PB2 eine Statistik gemacht, wieviele
    Kandidaten ueberbleiben wenn man der Reiche nach
    die klarsten Kandidaten entfernt aus der Datenbank.
    Und das mit rein zufaelligen Mutationen verglichen.
    Da gibt es deutliche Unterschiede, die Mutationen/Unterschiede
    sind nicht rein zufaellig verteilt auf die Regionen.
    Das kann aber auch andere Ursachen haben - ich bin
    mir nicht sicher.
    Jemand sollte das mal untersuchen ! Merkwuerdig dass das
    nicht laengst geschehen ist...

  10. #10
    Avatar von Tadorna
    Registriert seit
    26.08.2005
    Beiträge
    167
    Es geht für mich nicht um die Frage, ob Recombination vorkommt, sondern allenfalls, welche Rolle sie spielt.

    Für Niman steht aber seine Theorie des copy choice im Mittelpunkt, mit dem Aspekt der Voraussagbarkeit der Virusevolution, damit Möglichkeiten des Impfstoffdesigns, etc. Ich weiss nicht, was letztlich dran ist, mit seiner Patentschrift kann ich ziemlich wenig anfangen.

    Klar ist aber, dass das ganze steht und fällt mit der Eingangsfrage. Wenn sich herausstellen sollte, dass Rec. zumindest in der Form und Verbreitung, wie sie teilweise angenommen wird, nicht vorkommt, ist das copy choice Thema weitgehend obsolet.

    Ich vermute, es geht in erster Linie darum.

    Da gibt es deutliche Unterschiede, die Mutationen/Unterschiede
    sind nicht rein zufaellig verteilt auf die Regionen.
    Das kann aber auch andere Ursachen haben - ich bin
    mir nicht sicher.
    Das hat mit Sicherheit etwas mit Unterschieden in der Funktionalität der einzelnen Bereiche zu tun, ob Reco oder nicht.

Seite 1 von 4 1234 LetzteLetzte

Lesezeichen

Lesezeichen

Berechtigungen

  • Neue Themen erstellen: Nein
  • Themen beantworten: Nein
  • Anhänge hochladen: Nein
  • Beiträge bearbeiten: Nein
  •