PDA

Archiv verlassen und diese Seite im Standarddesign anzeigen : Recombination, Grundlagen, Stellenwert



Sarcelle
30.07.2007, 12:33
Vorraussetzung für Recombination ist nach jetziger Kenntnis eine Doppelinfektion mit zwei verschiedenen Virentypen in ein und derselben Zelle. In ausnahmefällen mag auch eine fehlerhafte Ablesung an der "falschen Stelle" eine Rolle spielen. Also:


ATGAAAGTGCCTAAAGTTGAATTAATTGTGGTTGT= Virus 1
ATGCAAGTGACTTAATATGAATTAATTGTGATTGT= Virus 2
ATGAAAGTGACTTAATATGAATTAATTGTGGTTGT= recombiniertes Tochtervirus
Das Tochtervirus enthält überwiegend Genmaterial von Virus 1 (=rot) mit Ausnahme eines kurzen Bereichs, der "versehentlich" von Virus 2 eingefügt wurde (unterstrichen). So kann es ganz schnell zu einer Otpimierung der Virus Fitness kommen, ohne dass lange Perioden von zufallsbedingten Mutationsprozessen abgewartet werden müssen.

eine solche Recombination ist im alignment leicht am plötzlichen Auftreten zahlreicher Änderungen ("Mismatches) bei, in den übrigen Bereichen bestehender, grosser Übereinstimmung zu erkennen.

Über die Bedeutung dieses Mechanismus gehen die Meinungen hochgradig auseinander, Die meisten, wie Webster glauben, dass R ziemlich selten ist, und die meisten Änderungen Zufallsmutationen sind.
Andere, wie Niman glauben, dass dies die Haupttriebfeder der Virusevolution ist, der nicht zufallsbedingt, sondern sogar steuerbar ist, (sog copy choice).

Wir werden diesen Disput nicht beantworten, allenfalls eine Meinung bilden können. Sicher ist, dass Rekombination vorkommt und einige unzweifelhafte Fälle dokumentiert sind.

Diie interessantere Frage ist, wie die Analysepraxis mit Doppelinfektionen umgeht. Ich denke mal, wenn für Virus 2 der Primer nicht passt, wird eben nur Virus 1 nachgewiesen. Kommt es beim zweiten Durchlauf zu einem anderen Ergebnis (was richtig wäre) so wird das als Fehler gewertet und verworfen. Vielleicht kommt es bei der RNA extraction schon zu Problemen.

Meinungen?

Klausemann
30.07.2007, 14:57
Meinungen nein, aber eine Zwischenfrage
Hallo Sarcelle,
ich spreche ja ungerne da zwichen :rotwerd ;) aber könntest du mir netter Weise erklären, was die Buchstabenreihen bedeuten ohne das ich einen Crashkurs als Viruloge starten muss .

Gruss Klaus

MonaLisa
30.07.2007, 15:17
Hallo Klaus,
schau mal hier:
http://de.wikipedia.org/wiki/Nukleotid

Die Buchstaben sind Abkürzungen für die 5 Nukleobasen aus denen unsere Gene bestehen. Sie stellen den Code der DNA oder RNA dar und dienen somit zur Identifizierung zB eines Virus. Die Buchstaben geben die Reihenfolge der Nukleobasen auf dem DNA-Strang an.

Gruß Petra

Black Giants
30.07.2007, 15:35
Ich bin zwar nicht Sarcelle, aber er wird mich sicher verbessern oder ergänzen, wenn was fehlt/falsch ist. ;)

Die vier Buchstaben stehen für die 4 Basen aus denen unsere Erbinformationen auf den Chromosomen aufgebaut sind.
A = Adenin
C = Cytosin
G = Guanin
T = Thymin
Es stehen sich immer A und T, bzw. C und G gegenüber.
Eine grafische Darstellung findet sich u.a. bei Wiki: DNS (http://de.wikipedia.org/wiki/Desoxyribonukleins%C3%A4ure)

Das Ganze sieht im Grunde aus wie ein Reißverschluß. Die Basen kann man sich wie die einzelnen Glieder vorstellen. Der Ruhezustand ist der geschlossene Reißverschluß, aber er kann auch aufgemacht werden.
Diese Basenpaare sind eigentlich nur ein Code für Substanzen, die die Zelle produzieren (synthetisieren) kann.

Ein Virus kann praktisch diese Kette aus Basen aufschneiden und den eigenen Code einfügen. Dadurch produziert die Zelle nicht mehr die Stoffe, die sie produzieren soll, sondern Kopien des Virus.

Was Sarcelle mit dem oben sagen wollte, war dass, wenn zwei verschiedene Viren in einer Zelle zusammentreffen und beide ihren genetischen Code dort einschleusen, hinterher ihre Kopien (denn nichts anderes sind ihre Nachkommen) verändert dort rauskommen. Sie haben was von beiden Viren abbekommen.
Diese Veränderung kann man in der Basenabfolge erkennen.

Hoffe, das hilft etwas. :)


PS: Hm, war mal wieder jemand schneller. :laugh

Klausemann
30.07.2007, 17:43
Danke euch beiden, ich denke es hat geholfen.

Jetzt meine Meinung dazu in Laienäsisch ;)

H5N1 ist eine unendliche Geschichte mit seinen immer wieder veränderten Untertypen , wo keiner genau weiss wo das endet und gegen das noch nicht mal Rumiflu hilft .

Es wird niemals einen Impfstoff gegen die Grippe geben.

Gruss Klaus

Sarcelle
30.07.2007, 19:12
Danke für die Hinweise. Fehlt eigentlich nur noch der Hinweis, dass
drei solche (Nucleo-)Basen, ein Basentriplett oder "Codon" ergeben, welches jeweils eine Aminosäure kodiert. Ein aus 60 Aminosäuren bestehendes Eiweiss benötigt zu seiner Kodierung also 60 Codons oder 180 Nucleobasen. Insgesamt könnten damit 4 (3) = 64 AS kodiert werden. Da aber nur 20 vorkommen, gibt es für einige Aminosäuren gleich mehrere unterschiedliche Codons.
http://de.wikipedia.org/wiki/Codon#Codon

Die fünfte wichtige Base ist das U (=Uracil), welches dem T (Thymidin) entspricht. In der DNA kommt Thymidin vor, diesem entspricht in der RNA das Uracil.

Damit die Zelle weiß, wo das Eiweis anfängt und wo die Kette zuende ist, wird noch ein Starcodon und ein Stopcodon benötigt. Das Startcodon ist im allgemeinen die Folge ATG. Als Stopcodon gibt es diverse Abfolgen: TAA, TAG. TGA.

Aus dem oben gesagten ( 64 Möglichkeiten, aber nur 20 AS) ergibt sich, dass nicht jede Änderung einer Base (Genotyp) zu einer anderen Aminosäure (Phänotyp) führen muss. In dem Fall spricht man von einer "silent (=synonyme) Mutation. Silent mutations erlauben aber eine Zuordnung, obwohl der Phänotyp identisch ist. Man kann das Verhätlnis aus silent (synomym)
zu den restlichen ("non synonyme") Mutationen bestimmen. Wenn optimale Anpassung und Firness vorliegt, findet man sehr viele silent (synonyme) mutations und nur wenige non synonyme Mutationen.

gsgs
02.04.2008, 11:33
http://www.flutrackers.com/forum/showthread.php?t=61120

Tadorna
06.04.2008, 11:29
http://www.flutrackers.com/forum/showthread.php?t=61120
Da findet ja eine kuriose Diskussion statt. Niman geht es m.M.n. in erster Linie darum, im Geschäft zu bleiben. Deshalb verteidigt er seine copy choice Theorie mit Zähnen und Klauen. Etwas wirklich überzeugendes habe ich bisher hierhzu nicht gefunden, genausowenig, wie er bisher recombinationen vorausgesagt hat.

Das ganze erinnert erntfernt an eine Verschwörungstheorie der anderen Art.

gsgs
06.04.2008, 12:56
ja, niman ist augenscheinlich voreingenommen hier.
Moeglicherweise aber die anderen Forscher auch ... in der anderen
Richtung. Olsen,Webster erwaehnen nicht die "Merkwuerdigkeit"
bei den Kanadischen Schweinen in ihren Artikeln ueber das
Thema.

Es es etliche Hinweise fuer Rekombination in H9N2
und H5N1, schwer vorstellbar dass das alles irgendwie
Laboratorium-Kontamination oder sonstige Fehler sein sollen.

Ich konnte allerdings bisher kein Beispiel finden dass klar zeigt
wie rekombinierte Grippe-Viren ueberleben und sich weiterverbreiten:
wenn man so ca. 1% der klarsten Kandidaten aus den
Datenbanken entfernt kann man keine klaren Rekombinations-
Hinweise mehr finden.


Fuer die niman-schen kurzen Rekombinationen (einzelne Nukleotide)
gibt es m.E. kaum Indizien, aber etliches was dagegen spricht.

-----------------------------

Nun hab' ich mal fuer PB2 eine Statistik gemacht, wieviele
Kandidaten ueberbleiben wenn man der Reiche nach
die klarsten Kandidaten entfernt aus der Datenbank.
Und das mit rein zufaelligen Mutationen verglichen.
Da gibt es deutliche Unterschiede, die Mutationen/Unterschiede
sind nicht rein zufaellig verteilt auf die Regionen.
Das kann aber auch andere Ursachen haben - ich bin
mir nicht sicher.
Jemand sollte das mal untersuchen ! Merkwuerdig dass das
nicht laengst geschehen ist...

Tadorna
07.04.2008, 10:59
Es geht für mich nicht um die Frage, ob Recombination vorkommt, sondern allenfalls, welche Rolle sie spielt.

Für Niman steht aber seine Theorie des copy choice im Mittelpunkt, mit dem Aspekt der Voraussagbarkeit der Virusevolution, damit Möglichkeiten des Impfstoffdesigns, etc. Ich weiss nicht, was letztlich dran ist, mit seiner Patentschrift kann ich ziemlich wenig anfangen.

Klar ist aber, dass das ganze steht und fällt mit der Eingangsfrage. Wenn sich herausstellen sollte, dass Rec. zumindest in der Form und Verbreitung, wie sie teilweise angenommen wird, nicht vorkommt, ist das copy choice Thema weitgehend obsolet.

Ich vermute, es geht in erster Linie darum.


Da gibt es deutliche Unterschiede, die Mutationen/Unterschiede
sind nicht rein zufaellig verteilt auf die Regionen.
Das kann aber auch andere Ursachen haben - ich bin
mir nicht sicher.

Das hat mit Sicherheit etwas mit Unterschieden in der Funktionalität der einzelnen Bereiche zu tun, ob Reco oder nicht.

gsgs
07.04.2008, 12:15
wie kannst du da sicher sein ? ...knifflig...
OK. "etwas" ist wohl richtig. Aber wieviel ?

Ich denke man kann wohl zumindest sagen, dass
Reassortment eine viel groessere Rolle spielt als Rekombination
fuer Influenza-Evolution. (IMO)

Tadorna
07.04.2008, 19:37
Ausgehend von der Annahme, dass die Mutationswahrscheinlichkeit über das Genom (nicht völlig, aber) weitgehend gleich ist, stellt sich doch die Frage, wieso sich in einigen regionen die Mutationen häufen, während andere konserviert bleiben.

U.a. hieraus lässt sich schliessen, dass dies etwas mit viral fitness, also der Funktionalität zu tun haben muss. Im HA Molekül sind die funktionellen Bereiche nicht mit denjenigen Identisch, die die Epitope bilden. das ist ja die Krux.

gsgs
07.04.2008, 21:52
in HA ist es klar, dass wegen der Immunitaet im vorderen Teil
(HA1) mehr mutiert wird. Oder besser: mehr Mutationen ueberleben.

Dann gibt es einige Bereiche (z.B. in PA, glaub ich), die fuer das
Packen der Segmente verantwortlich sind,
hier werden Nukleotide erkannt und die muessen weitgehend konserviert sein.

Und dann haengen die Mutationen evtl. von der 3d-Struktur ab.
Manche Mutationen ueberleben vielleicht nur, wenn gleichzeitig in der
Naehe noch weitere Veraenderungen stattfinden

Tadorna
08.04.2008, 10:14
in HA ist es klar, dass wegen der Immunitaet im vorderen Teil
(HA1) mehr mutiert wird. Oder besser: mehr Mutationen ueberleben.
Ja, wichtig ist die Feststellung, dass mehr Mutationen (Reco eingeschlossen) die viral fitness nicht beeinträchtigen. Wieviele Mutationen in einem Organismus während einer Infektion entstehen und unbemerkt wieder untergehen, ist auch unbekannt.

Die weiter oben angegebenen Mutationen /Jahr beziehen sich ja nicht hierauf sondern auf (temporär jeweils stabile) Sequenzen, die über einen längeren Zeitraum beobachtet werden.

Das Hauptproblem und auch die Eigentümlichkeit der Influenza scheint jedenfalls zu sein, dass, v.a. im HA, die Epitope, also die immunologisch relevanten Regionen, funktionell keine Bedeutung zu haben scheinen, und deshalb sozusagen frei variierbar sind ohne Nachteil für das Virus.

Versuche, konservierte Regionen im HA für die Immunisierung zu nutzen, sind bisher ziemlich erfolglos geblieben.

Bei der gegen konservierte Regionen innerer Gene, v.a. NP, NS1, M1 gerichteten T-Zell Immunität ist das anders, aber diese ist weniger protektiv.


Und dann haengen die Mutationen evtl. von der 3d-Struktur ab.
Ja, ein bekanntes Beispiel ist die doppelt gelesene Schleife, sozusagen eine Stolpern der PM, in der Cleavage Region, die einer vermehrten Anordnung der Basen führt.
So wie es Suarez beschreibt, klingt es jedenfalls überzeugend.

gsgs
08.04.2008, 15:41
Ja, ein bekanntes Beispiel ist die doppelt gelesene Schleife, sozusagen eine Stolpern der PM, in der Cleavage Region, die einer vermehrten Anordnung der Basen führt.
So wie es Suarez beschreibt, klingt es jedenfalls überzeugend.

PM=polymerase ?
quote ? keyword ?
from this paper ?
http://www.cdc.gov/ncidod/EID/vol10no4/03-0396.htm

Tadorna
08.04.2008, 17:19
Nein, hier geht es um eine nicht hetrerogene Reco.

Sorry, ich meinte die Arbeit von Garcia und Per (http://vir.sgmjournals.org/cgi/reprint/77/7/1493)due

gsgs
09.04.2008, 12:10
Mexiko 1994

HA - Mutationen:

http://magictour.free.fr/panflu/mexh5


cleavage:
1-8:KE
10-18:RKRK
15:RKRKRK
rest:RE

Tadorna
09.04.2008, 15:04
Der Clou an der Sache ich aber ein anderer. Da geht die Statistik am Kern vorbei

gsgs
09.04.2008, 16:02
fass doch mal kurz zusammen, was /wo der Clou ist !

hier noch die vollen genome von 12 mexikanischen 'Viren.
2 verschiedene HP : in Puebla und Queretaro





00000000000000000000000000000001111111111111111111 2222 00000000000000000000000000111111111111111111122222 22 00000000000000000000000000000111111111111111111222 00000000000000000000000000000000000000000000000000 0000000000000000011111 000000000000000000000000000111111 0000000000000000000000000000000000011111111111111 000000000000000000000000 0000000000000000000000000000000
01112222333334444555666677778890123333344455666889 0022 00122233333444556666678899001113446666677789901112 22 11122222333333444444566678899000001122344555567001 00000111111222222233333333344444455555555566666777 7777777788888899900000 011222333333344444455677899001233 0011112223333444455556778888899999900000011122222 012222334456667777888889 0011111122222233444445666666777
44792358069991477289113923791200791678935601244996 3403 58322902669556660245933747031467480223857850202591 24 24501778011377013489705792448155697828958045685784 78899011279011348912335666800245912334555935559112 3345789945558946701344 425479001346912456701826445261658 5617791890248035817880261234824456712278912800488 690678150622391168014679 5804588900577847334780556788049
51188422701361147858076068320858337599288508324469 7705 77258137169019470724651955823871018795389242374101 61 07963790359368884402332802861813020584928075912155 92814248155501048568232245536432976689049982697019 0621974573674964032346 030061095849613138473468187993906 6480245655295937444124261951380307685627916305358 859563386998970496591658 0903557303378415590926249748248
-codon-position------------------------------------ 1 1 112 2 2 2 1 1 1 1 1 11 1 11 2 2 1 2 1 1 1 1 12 1 1 21 11 1 1 1 21 1 1 11111 111 1 121 1112 121211112211121 1212212212 1111212 111222111111 2 1 22 1 1 21121221121111111112 1211111111121112 111111 2111 2 21 1111111 12 1 1 1222 221222112211222 122221 2 1
---Index-------------------------------------------AAGCTGACCCGCAGATCCGGGAATTAATCAAACTCTTTCAGGGCGAATTC GGTA AAACGTTAGCTATGAAAAAGGGTTCGCCAGCCGGAAATAGAGCCCGCTCC GG TCTTAAGATCGTGACCACACAGGTCTTAACGACGGCTGACAAGTTGACTC CACTTCCAGGGTAACTTAGTGCGGCGTCTATGTAGATAAAGTAGCAGGAA GCGGCTACTAAGGGTCCACCGG CAAAACTCGAGGGATTGCGTTAGGCCCGAGTCG GAGGGGATGACCCTTGCCCGAATGCAACAAGCACTCAACTTCGCAAATT GATCTGGGCCAGTCCAGCGTTTCG GGGTACTTAATGCTCGCTTACAAGCGCAGGG
1 >A/chicken/Puebla/231-5284/98 (H5N2) G.A..AG...ATG.G...A.....------------------------------ .....CC...C...-------------------------------------- C.C.GG..CA..A....TGA------------------------------ ..........A...TCA.T..T..A.C..CCACGAG...T.AGAT...TG ATA.T...CG.........TA. TGGG...T.GAAAGGC...CC------------ A.T.A...AG.T...A..TAG..A..GT...TG.....A.....C..CC ...........A.T.G..A....A A....TC..GA..CA.A..TATG.T..G.AA 456 216 , 183 106 1:>A/chicken/Puebla/231-5284/98 (H5N2)
2 >A/chicken/Aguascalientes/124-3705/98 (H5N2) G.A..A....ATG.G...A.....------------------------------ G....C...TC...-------------------------------------- C.C.GG..CA.......TGA------------------------------ T........AA...TCA.T..T..A.C..CC.CGAG.G.T.AGAT...TG ATAAT...CG......T..TA. TGGG...T.GAA.GGC...CC------------ A.T.....AG.....A..TAG..A..GT....G.....A.....C..CC A.C...A.....CTTG.....C.A A....TC..GA..CA....TATG.T..G.AA 434 218 , 161 108 2:>A/chicken/Aguascalientes/124-3705/98 (H5N2)
3 >A/chicken/Queretaro/14588-19/1995(H5N2) .G..................T.....................A.A..... .... ...............C.T........T......................T A. ....G...C.....T...GA.........T.......A............ .......................A.............G........A... .....C.A....A..TT.T..A ....GT...............G....T..A... .....AG....T...A...A......G.....G................ ......AA...A..T...A..C.. ........CGA...G......TG....G... 141 51 , 119 51 3:>A/chicken/Queretaro/14588-19/1995(H5N2)
4 >A/Chicken/Hidalgo/26654-1368/94 (H5N2) .G.....A.....A.G....T.....G................T...... ...G ...............C........A...............T...T..... .A ...................................A........C...CA GCTGCTGG...GTG.........A.T........................ .....C......A......... ....GT...........T............... ......G....T........................G............ ------------------------ .A.CG..C...............A....A.. 153 68 , 46 44 4:>A/Chicken/Hidalgo/26654-1368/94 (H5N2)
5 >A/Chicken/Mexico/26654-1374/94 (H5N2) .G.....A.....A.G....T.....G................T...... ...G ...............C........A...............T...T..... .A ...................................A........C...CA GCTGCTGG...GTG.........A.T........................ .....C......A......... ....GT...........T............... ......G....T........................G............ ----A------------------- .A.CG..C...............A....A.. 154 68 , 48 45 5:>A/Chicken/Mexico/26654-1374/94 (H5N2)
6 >A/chicken/Hidalgo/28159-232/1994(H5N2) .G...........A.GT...TG.....................T...... .... G..............N........A...............T...T..... .A ...................................A........C...CA .......................A.T..........C...A....G.... .....C......A......... ....GT...........T............... ......G....T........................G............ .G........G.....AA.C.... .A.CG..C...............A....... 55 40 , 55 40 6:>A/chicken/Hidalgo/28159-232/1994(H5N2)
7 >A/chicken/Hidalgo/232/94 (H5N2) .G...........A.GT...TG..------------------------------ G.............-------------------------------------- ....................------------------------------ .......................A............C...A....G.... .....C......A......... ....GT...........T...------------ ......G....T........................G............ .G........G.....AA.C.... ------------------------------- 357 165 , 28 24 7:>A/chicken/Hidalgo/232/94 (H5N2)
8 >A/chicken/Mexico/31381-7/94 (H5N2) ......G..T..............------------------------------ ......C.......-------------------------------------- .............T......------------------------------ ....G....................................A..T..... ..AA...T..G........... ............A........------------ ..........T..........C...C.............C...T..... ..C.........C.T......... ............................... 336 130 , 63 20 8:>A/chicken/Mexico/31381-7/94 (H5N2)
9 >A/Chicken/Puebla/8623-607/94 (H5N2) ...A.....T..G.......A.G.CG.CTGGGTCTCCATGAA...GCGCT AAC. .TTTT...AA..CAG.GGGAAAAC.A.AGATTAATGCCGA.ATT.TTCTT .. .T.A..AG..A.ATTTG...CAACACCTG.AGAAT.G.TTGGAC.TGA.. ..........A....C.G...T........A............AT.A... ATAA..TT.......T..T..A ......A.A...A...A.A..GAATT.ACAATA ...AC.....T..CC.T....CA.TC..CG....C....C......G.. ----AA------------------ ..A.....CGA....ATCC............ 277 183 , 176 161 9:>A/Chicken/Puebla/8623-607/94 (H5N2)
10 >A/Chicken/Puebla/14585-622/94 (H5N2) ...A.....T..G.......A.G.CG.CTGGGTCTCCATGAA...GCGCT AAC. .TTTT...AA..CAG.GGGAAAAC.A.AGATTAATGCCGA.ATT.TTCTT .. .T.A..AG..A.ATTTG...CAACACCTG.AGAAT.G.TTGGAC.TGA.. ------------------------------------------------------------------------ ......A.A...A...A.A..GAATT.ACAATA ...AC....GT.ACC.T....CA.TC..CG....C....C......G.. ----A------------------- ..A.....CGA....ATCC............ 410 240 , 154 145 10:>A/Chicken/Puebla/14585-622/94 (H5N2)
11 >A/chicken/Puebla/28159-474/95 (H5N2) ....CA..T........A.A...G------------------------------ .......G...G..-------------------------------------- ...........C.T......------------------------------ ........AA.......G.CT.T....TC..A......G........A.. ......TT..GA.AC..G.... ............A....TA..------------ .G...A.A.GT.T....T...C...C....AT.T.T.G.CCAA..G... A..A...TTTG.........C.T. ...........TT.A........A.TT.... 350 174 , 77 64 11:>A/chicken/Puebla/28159-474/95 (H5N2)
12 >A/chicken/Chis/15224/1997(H5N2) ....CA..T........A.A...G......G..C......A.A.A.CG.. ..C. ...TT..G...G....G........AT.GA....G...G......T.... A. ...........C.T......CAA.A.C.GT.......A............ ........AA.......G.CT.T....TC........GG..C.....A.. ......TT..GA.AC..G.... ....GT...........T........T...... .G...A.A.GT.T....T...C...C....A..T.T.G.CCAAT.G... A..A.A.TTTG.........C.T. ...........TT.A.T..T...A.TT.... 261 96 , 261 96 12:>A/chicken/Chis/15224/1997(H5N2)



die HP-Puebla Viren scheinen eine ganz andere Variante zu sein
und sind wohl nicht 1993/4 aus den anderen Viren "entstanden",
der gemeinsame Ahnherr liegt weiter zurueck.
Sie aehneln dem Chis/15224/1997

Indizien fuer Reassortment in Chis (NP) und 26654 (HA)

Tadorna
09.04.2008, 17:05
Lies doch einfach die Arbeit, da ist es ausführlich beschrieben.

Die Aneinanderreihung von Sequenzen bringt in diesem Zusammenhang nichts.

gsgs
09.04.2008, 17:41
das wollte ich doch gerade vermeiden (und vermutlich viele andere auch). Das dauert Stunden.

Wir brauchen mehr kurze Zusammenfassungen !
We need summaries !

soll LP nach HP mutiert sein ?

Tadorna
09.04.2008, 19:37
Na ja, Arbeiten, über die man redet, sollte man schon gelesen haben, das dauert miestens auch keine Stunden.

Der "Clou" ist das "Schlüpfen" der RNA Polymerase an einer RNA Schlinge, die in der Cleavage Region auftritt, was zu einer Doppeltransscription der basischen AA führt. Was das hinsichtlich Pathogenität bedeutet, dürfte bekannt sein.

gsgs
10.04.2008, 15:16
und, glaubst du an diese Schluepftheorie ?

Warum passiert das dann nicht oefter ?
Warum nur an der cleavage site ?

Tadorna
10.04.2008, 21:07
Was ich glaube, ist reichlich uninteressant.

Die Hypothese gibt aber zumindest eine sehr plausible Erklärung.

Übrigens wurde die Theorie bisher kaum kontrovers diskutiert.


Warum passiert das dann nicht oefter ?Ich weiss nicht ob das so selten vorkommt. LPAI > HPAI Übergänge gelten ja als nicht so selten und sind Grundlage für die Keulvorgaben bei LPAI Epidemien.


Warum nur an der cleavage site ?
Wirklich nur an der cleavage site? Wodurch könnte denn die Stalk deletion im NA (meist bei Übergang auf Hühner) zustandekommen? Könnte auch so was ähnliches sein. Vemutlich sind nicht alle Regionen so genau in ihrer Sekundärstruktur untersucht wie die Cleavage site.

gsgs
11.04.2008, 07:27
bei anderen LP-->HP Uebergaengen sind aber andere Mechanismen
angenommen worden, soweit ich weiss.

Stalk _deletion_ ist nicht eine Verdopplung einer Teil-Sequenz
wie hier vorgeschlagen

Ein Einschub von 6 Nukleotiden wie hier kommt bei 50000
anderen oeffentlich zugaenglichen Grippe-Sequenzen
mit insgesamt 50M Nukleotiden anderswo nicht vor,
soweit ich weiss.

Ich hab' mal email geschrieben an Perdue...


-----------1----------------------

Perdues emails kommen zurueck, ich kann die aktuelle email-Adresse nicht so
einfach finden. Hab stattdessen an Garcia geschrieben

Dann fand ich:

> Insertion of two additional basic amino acids at the cleavage site has been observed
> in many highly pathogenic AIVs and the possible mechanism of such insertion was
> postulated previously (6, 23).

in:

http://jvi.asm.org/cgi/content/full/79/17/11412

mit Referenz:

23: Perdue, M. L., and D. L. Suarez. 2000. Structural features of the avian influenza virus
hemagglutinin that influence virulence. Vet. Microbiol. 74:77-86.[CrossRef][Medline]

-------------2--------------------

http://www.ncbi.nlm.nih.gov/pubmed/10799780?dopt=Abstract

Tadorna
11.04.2008, 08:08
Ich frage miche, welche. Reading error.

Ein Ausfall von Nt's könnte ja demselben slipping Mechanismus unterliegen, z.B. Überspringen einer Schleife an der Basis. Das war gemeint.

Es geht nicht um den "blossen Einschub" von Nucleotiden, sondern um eine Verdoppelung.

Allerdings habe ich keine Zweifel, dass es den "einen" Mechanismus nicht gibt.

Tatsache ist, dass die RNA transscription durch die PM von diversen Gegebenheiten gestört werden kann.

Um zum Eingangsthema zurückzukommen. Für ein "copy choice" gibt es außer in einer Patentschrift nicht viel Belege und schon gar keinen Erklärungsansatz für den Mechanismus.

gsgs
11.04.2008, 08:40
they didn't mention this possible doubling by the polymerase here:

http://jvi.asm.org/cgi/content/full/75/9/4439

Generation of a Highly Pathogenic Avian Influenza A Virus from an Avirulent Field Isolate by
Passaging in Chickens

In Chile 2003 a region from NP was inserted into HA


wir haben ja HA1 und HA2, vielleicht macht ja die Polymerase eine Pause nach
HA1 ? (oder kommt sie vom anderen Ende, keine Ahnung)
Und dann sich da irgendwie was anlagern, bevor es weitergeht.
Oder HA1 und HA2 werden ganz getrennt hergestellt und
erst hinterher zusammengefuegt

gsgs
11.04.2008, 08:47
PM=polymerase ? (private message,

es gibt diese Rekombinationen anscheinend haeufig bei anderen Viren
und Organismen

Und bei Influenza gibt es mehrere deutliche Anzeichen,
kaum vorstellbar dass das alles irgendwie Fehler sein
sollen.

Tadorna
11.04.2008, 16:50
In der Arbeit geh es um die HA Veränderung durch schrittweise Mutation bei mehrfacher Passage in Luftsack und Hirn gewebe, mit nachfolgender Selektion von virulenten Stämmen, da sich nur diese in Hirn vermehren. Das ist aber rein experimentell, und kommt in der Natur nicht vor, sagen jedenfalls die Autoren.

In der anderen Arbeit geht es aber um Verdoppelung eines kurzen segmentes.

gsgs
12.04.2008, 09:11
angebliche,hypothetische "Verdopplung" nur 6 Nukleotide.


In Texas 3 Nukleotide in Chile 20 oder so
in Italien 2000
British Columbia
Mexico


eine vollstaendige Liste mit LP-->HP Uebergaengen
und vermuteter cleavage-Aenderung waere gut

gsgs
12.04.2008, 17:26
http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=372854&blobtype=pdf

(Lai,1992)

page 12-15 explains recombination in RNA-viruses



new recombination statistics:

http://www.setbb.com/fluwiki2/viewtopic.php?t=387&mforum=fluwiki2

seems that there is considerably more recombination in birds and swine
than in humans. Worömm ?